Stefan Claas wrote:
Hi all,
last year I read about DNA encryption and I thought, since I have
a bit time, to try it out. The interesting thing with DNA encryption
is a laboratory can use its expensive equipment to inject the results
into plants for example, so that the cipher text is hidden from third
parties and transport the plant around and nobody knows that the plant carries an encrypted message, which can then later been extracted.
Here is my Go program. It uses TPM 2.0 Hardwarer module to generate the
keys and then does a XOR operation.
C:\Users\xxxxxxxx\Desktop>dnacrypt genkey 52 key.txt
Random DNA key of length 52 generated using TPM 2.0 and saved to 'key.txt'.
C:\Users\xxxxxxxx\Desktop>dnaentropy key.txt
Shannon entropy of the DNA key (52 bases): 1.9397
✔ The key has high entropy and appears well-distributed.
C:\Users\xxxxxxxx\Desktop>dnacrypt encrypt msg.txt key.txt out.txt
Plaintext as DNA (first 20 bases): TACATCTTTCGATCGATCGG...
Encryption complete. Ciphertext DNA saved to 'out.txt'.
Ciphertext: GGTAGGTTCAGCGAGGGCCGGTCATCATAGACCTGATGAGCTTCGCCT
I think this is an interesting experiment and is pretty cool
hidden encryption, even the NSA or CIA can't detect.
I think with Microsoft's DNA ink and other cheap DNA kits available,
undectable DNA Crypto is possible... How cool is that?
Regards
Stefan
--- SoupGate-Win32 v1.05
* Origin: fsxNet Usenet Gateway (21:1/5)